DNA for Beginners
Help
Create the complimentary strand for the DNA strand: AACGGTCCAGTCCAAGTTACG
TTGCCAGGTCAGGTTCAATGC
The two men who established the structure of DNA by stealing important scientific evidence were:
Watson and Crick
The "rungs" of the DNA ladder are made of
2 nitrogen bases
Unlock this slideshow and over 2 million more with Baamboozle+
Try slideshows
Your experience on this site will be improved by allowing cookies.
Allow cookies