Edit Game
DNA for Beginners
 Delete

Use commas to add multiple tags

 Private  Unlisted  Public



 Save


Get beautiful free images


Delimiter between question and answer:

Tips:

  • No column headers.
  • Each line maps to a question.
  • If the delimiter is used in a question, the question should be surrounded by double quotes: "My, question","My, answer"
  • The first answer in the multiple choice question must be the correct answer.

 Import questions


Get beautiful free images






 Save   14  Close
What holds the 2 strands of DNA together to make the "twisted ladder"
Hydrogen Bonds
Why do our cells need to go through DNA replication?
Every new cell produced in our bodies needs its own set of DNA.
Which sequence of DNA bases would pair with this partial strand ATG TGA CAG
TAC ACT GTC
In a molecule of double-stranded DNA, Adenine is always equal to
Thymine
Which 2 molecules form the sides (backbone) of the DNA ladder?
phosphate and sugar
Nucleotides are made up of a sugar, phosphate, and..?
nitrogen bases
Who took photo 51, giving the major evidence of the DNA structure?
Rosalind Franklin
How did Rosalind Franklin's photo 51 affect the work of Watson and Crick?
provided the evidence to show the number of strands
Where does DNA replication take place?
Nucleus
What sugar is in DNA?
deoxyribose
What is the long name for DNA?
deoxyribonucleic acid
The "rungs" of the DNA ladder are made of
2 nitrogen bases
The two men who established the structure of DNA by stealing important scientific evidence were:
Watson and Crick
Create the complimentary strand for the DNA strand: AACGGTCCAGTCCAAGTTACG
TTGCCAGGTCAGGTTCAATGC


Get beautiful free images

Your experience on this site will be improved by allowing cookies.