Game Preview

DNA for Beginners

  •  English    14     Public
    This game is to review the topic of DNA. The level is BEGINNERS.
  •   Study   Slideshow
  • Create the complimentary strand for the DNA strand: AACGGTCCAGTCCAAGTTACG
    TTGCCAGGTCAGGTTCAATGC
  •  15
  • The two men who established the structure of DNA by stealing important scientific evidence were:
    Watson and Crick
  •  15
  • The "rungs" of the DNA ladder are made of
    2 nitrogen bases
  •  15
  • What is the long name for DNA?
    deoxyribonucleic acid
  •  15
  • What sugar is in DNA?
    deoxyribose
  •  15
  • Where does DNA replication take place?
    Nucleus
  •  15
  • How did Rosalind Franklin's photo 51 affect the work of Watson and Crick?
    provided the evidence to show the number of strands
  •  15
  • Who took photo 51, giving the major evidence of the DNA structure?
    Rosalind Franklin
  •  15
  • Nucleotides are made up of a sugar, phosphate, and..?
    nitrogen bases
  •  15
  • Which 2 molecules form the sides (backbone) of the DNA ladder?
    phosphate and sugar
  •  15
  • In a molecule of double-stranded DNA, Adenine is always equal to
    Thymine
  •  15
  • Which sequence of DNA bases would pair with this partial strand ATG TGA CAG
    TAC ACT GTC
  •  15
  • Why do our cells need to go through DNA replication?
    Every new cell produced in our bodies needs its own set of DNA.
  •  15
  • What holds the 2 strands of DNA together to make the "twisted ladder"
    Hydrogen Bonds
  •  15